HADHB (NM_001281513) Human Untagged Clone

CAT#: SC336199

HADHB (untagged) - Human hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit (HADHB), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HADHB
• Synonyms: ECHB; MSTP029; MTPB; TP-BETA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281513, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACACTGGTTTCTGGTTGGCTCCTATATGGATGGATCATTGCTGTCCAGACCAAAACGAAGAAGACGT
  TAGCCAAACCCAATATAAGGAATGTTGTGGTGGTGGATGGTGTTCGCACTCCATTTTTGCTGTCTGGCAC
  TTCATATAAAGACCTGATGCCACATGATTTGGCTAGAGCAGCGCTTACGGGTTTGTTGCATCGGACCAGT
  GTCCCTAAGGAAGTAGTTGATTATATCATCTTTGGTACAGTTATTCAGGAAGTGAAAACAAGCAATGTGG
  CTAGAGAGGCTGCCCTTGGAGCTGGCTTCTCTGACAAGACTCCTGCTCACACTGTCACCATGGCTTGTAT
  CTCTGCCAACCAAGCCATGACCACAGGTGTTGGCTTGATTGCTTCTGGCCAGTGTGATGTGATCGTGGCA
  GGTGGTGTTGAGTTGATGTCCGATGTCCCTATTCGTCACTCAAGGAAAATGAGAAAACTGATGCTTGATC
  TCAATAAGGCCAAATCTATGGGCCAGCGACTGTCTTTAATCTCTAAATTCCGATTTAATTTCCTAGCACC
  TGAGCTCCCTGCGGTTTCTGAGTTCTCCACCAGTGAGACCATGGGCCACTCTGCAGACCGACTGGCCGCT
  GCCTTTGCTGTTTCTCGGCTGGAACAGGATGAATATGCACTGCGCTCTCACAGTCTAGCCAAGAAGGCAC
  AGGATGAAGGACTCCTTTCTGATGTGGTACCCTTCAAAGTACCAGGAAAAGATACAGTTACCAAAGATAA
  TGGCATCCGTCCTTCCTCACTGGAGCAGATGGCCAAACTAAAACCTGCATTCATCAAGCCCTACGGCACA
  GTGACAGCTGCAAATTCTTCTTTCTTGACTGATGGTGCATCTGCAATGTTAATCATGGCGGAGGAAAAGG
  CTCTGGCCATGGGTTATAAGCCGAAGGCATATTTGAGGGATTTTATGTATGTGTCTCAGGATCCAAAAGA
  TCAACTATTACTTGGACCAACATATGCTACTCCAAAAGTTCTAGAAAAGGCAGGATTGACCATGAATGAT
  ATTGATGCTTTTGAATTTCATGAAGCTTTCTCGGGTCAGATTTTGGCAAATTTTAAAGCCATGGATTCTG
  ATTGGTTTGCAGAAAACTACATGGGTAGAAAAACCAAGGTTGGATTGCCTCCTTTGGAGAAGTTTAATAA
  CTGGGGTGGATCTCTGTCCCTGGGACACCCATTTGGAGCCACTGGCTGCAGGTTGGTCATGGCTGCTGCC
  AACAGATTACGGAAAGAAGGAGGCCAGTATGGCTTAGTGGCTGCGTGTGCAGCTGGAGGGCAGGGCCATG
  CTATGATAGTGGAAGCTTATCCAAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281513
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001281513.1, NP_001268442.1
• RefSeq Size: 2279 bp
• RefSeq ORF: 1359 bp
• Locus ID: 3032
• Cytogenetics: 2p23.3
• Protein Pathways: Fatty acid elongation in mitochondria, Fatty acid metabolism, Metabolic pathways, Valine, leucine and isoleucine degradation
• Gene Summary: 'This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (3) includes an alternate exon in the 5' coding region and uses a downstream start codon compared to variant 1. The resulting protein (isoform 3) is shorter and has a distinct N-terminus compared to isoform 1.