PTGS1 (NM_001271367) Human Untagged Clone
CAT#: SC336201
PTGS1 (untagged) - Human prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant 6
"NM_001271367" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTGS1 |
Synonyms | COX1; COX3; PCOX1; PES-1; PGG/HS; PGHS-1; PGHS1; PHS1; PTGHS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001271367, the custom clone sequence may differ by one or more nucleotides
ATGCTCATGCGCCTGGTACTCACAGTGCGCTCCAACCTTATCCCCAGTCCCCCCACCTACAACTCAGCAC ATGACTACATCAGCTGGGAGTCTTTCTCCAACGTGAGCTATTACACTCGTATTCTGCCCTCTGTGCCTAA AGATTGCCCCACACCCATGGGAACCAAAGGGAAGAAGCAGTTGCCAGATGCCCAGCTCCTGGCCCGCCGC TTCCTGCTCAGGAGGAAGTTCATACCTGACCCCCAAGGCACCAACCTCATGTTTGCCTTCTTTGCACAAC ACTTCACCCACCAGTTCTTCAAAACTTCTGGCAAGATGGGTCCTGGCTTCACCAAGGCCTTGGGCCATGG GGTAGACCTCGGCCACATTTATGGAGACAATCTGGAGCGTCAGTATCAACTGCGGCTCTTTAAGGATGGG AAACTCAAGTACCAGGTGCTGGATGGAGAAATGTACCCGCCCTCGGTAGAAGAGGCGCCTGTGTTGATGC ACTACCCCCGAGGCATCCCGCCCCAGAGCCAGATGGCTGTGGGCCAGGAGGTGTTTGGGCTGCTTCCTGG GCTCATGCTGTATGCCACGCTCTGGCTACGTGAGCACAACCGTGTGTGTGACCTGCTGAAGGCTGAGCAC CCCACCTGGGGCGATGAGCAGCTTTTCCAGACGACCCGCCTCATCCTCATAGGGGAGACCATCAAGATTG TCATCGAGGAGTACGTGCAGCAGCTGAGTGGCTATTTCCTGCAGCTGAAATTTGACCCAGAGCTGCTGTT CGGTGTCCAGTTCCAATACCGCAACCGCATTGCCATGGAGTTCAACCATCTCTACCACTGGCACCCCCTC ATGCCTGACTCCTTCAAGATCGGTGGGGGCAGGAACATGGACCACCACATCCTGCATGTGGCTGTGGATG TCATCAGGGAGTCTCGGGAGATGCGGCTGCAGCCCTTCAATGAGTACCGCAAGAGGTTTGGCATGAAACC CTACACCTCCTTCCAGGAGCTCGTAGGAGAGAAGGAGATGGCAGCAGAGTTGGAGGAATTGTATGGAGAC ATTGATGCGTTGGAGTTCTACCCTGGACTGCTTCTTGAAAAGTGCCATCCAAACTCTATCTTTGGGGAGA GTATGATAGAGATTGGGGCTCCCTTTTCCCTCAAGGGTCTCCTAGGGAATCCCATCTGTTCTCCGGAGTA CTGGAAGCCGAGCACATTTGGCGGCGAGGTGGGCTTTAACATTGTCAAGACGGCCACACTGAAGAAGCTG GTCTGCCTCAACACCAAGACCTGTCCCTACGTTTCCTTCCGTGTGCCGGATGCCAGTCAGGATGATGGGC CTGCTGTGGAGCGACCATCCACAGAGCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271367 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001271367.1, NP_001258296.1 |
RefSeq Size | 4905 bp |
RefSeq ORF | 1362 bp |
Locus ID | 5742 |
Cytogenetics | 9q33.2 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Arachidonic acid metabolism, Metabolic pathways |
Gene Summary | 'This is one of two genes encoding similar enzymes that catalyze the conversion of arachinodate to prostaglandin. The encoded protein regulates angiogenesis in endothelial cells, and is inhibited by nonsteroidal anti-inflammatory drugs such as aspirin. Based on its ability to function as both a cyclooxygenase and as a peroxidase, the encoded protein has been identified as a moonlighting protein. The protein may promote cell proliferation during tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (6) uses two alternate splice sites at internal exons, compared to variant 1. These differences result in initiation of translation at an alternate downstream in-frame start site, compared to variant 1. The primary ORF can be translated due to a combination of reinitiation and leaky scanning. The encoded isoform (5) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238307 | PTGS1 (myc-DDK-tagged) - Human prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1), transcript variant 6 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review