Chimaerin 2 (CHN2) (NM_001293070) Human Untagged Clone
CAT#: SC336378
CHN2 (untagged) - Human chimerin 2 (CHN2), transcript variant 4
"NM_001293070" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CHN2 |
Synonyms | ARHGAP3; BCH; CHN2-3; RHOGAP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001293070, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGTCCAGCAACTCCAGCCTGTCCGGCTCGTCGGTGTCCTCCGTCTATTCTGAACCCAGAAGCC CGAGAGAGCTTCCAAAATATGCTGAAGAATACCAGCCTCCTATATGGAAATCATACTTATATCAGTTACA GCAAGAGGCACCTCGTCCCAAGAGAATCATTTGTCCTCGGGAGGTGGAAAACAGACCAAAATATTATGGA AGAGAGTTTCATGGGATCATCTCTCGGGAGCAGGCGGATGAGCTTCTTGGAGGCGTGGAGGGTGCCTACA TCCTTAGAGAAAGCCAGCGGCAACCAGGATGCTACACGCTGGCTCTCAGGTTTGGAAACCAGACCTTAAA CTACAGGCTCTTCCACGACGGGAAACACTTTGTGGGTGAGAAGAGGTTTGAGTCGATTCATGATCTGGTG ACAGATGGCTTGATAACACTGTACATAGAAACAAAAGCTGCCGAGTACATTTCAAAAATGACAACTAACC CCATCTATGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAGGCTGAGCAGGTCTAA AAATGAACCAAGAAAAACAAACGTCACACATGAAGAACACACAGCGGTGGAAAAGATCTCCTCCCTGGTT CGAAGGGCTGCCCTCACACACAACGACAACCACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACA CGTTCCGAGGCCCACACTGGTGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCG GTGCTCAGACTGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAACCTGAT CTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACAACACTTGTGAAGGCTCACAACACTCAGAGAC CCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGAGGATTAAAATCGGAAGGCCTTTACAGAGT CTCTGGGTTCACTGAACACATTGAAGATGTCAAAATGGCATTTGACAGAGATGGTGAAAAGGCCGATATA TCTGCCAATGTCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCCA TCCCTGTCATCACATATGATACCTATTCCAAATTTATAGATGCAGCAAAAATCTCCAATGCAGATGAGAG GCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCTGCCCACTATGAAACCCTCCGGTACCTAATG ATCCACCTCAAAAAGGTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGT TTGGGCCCACTCTGATGAGGCCCCCTGAGGACAGCACCCTGACCACCCTGCATGATATGCGGTACCAAAA GCTGATTGTGCAGATTTTAATAGAAAACGAAGACGTTTTATTCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001293070 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001293070.1, NP_001279999.1 |
RefSeq Size | 3500 bp |
RefSeq ORF | 1446 bp |
Locus ID | 1124 |
Cytogenetics | 7p14.3 |
Gene Summary | 'This gene encodes a guanosine triphosphate (GTP)-metabolizing protein that contains a phorbol-ester/diacylglycerol (DAG)-type zinc finger, a Rho-GAP domain, and an SH2 domain. The encoded protein translocates from the cytosol to the Golgi apparatus membrane upon binding by diacylglycerol (DAG). Activity of this protein is important in cell proliferation and migration, and expression changes in this gene have been detected in cancers. A mutation in this gene has also been associated with schizophrenia in men. Alternative transcript splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, May 2014]' Transcript Variant: This variant (4) differs in the 5' UTR and contains multiple additional 5' coding exons, compared to variant 1. It represents use of an alternate promoter and initiates translation from an alternate start codon. The encoded isoform (4) has a distinct N-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238484 | CHN2 (myc-DDK-tagged) - Human chimerin 2 (CHN2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review