CD30 (TNFRSF8) (NM_001281430) Human Untagged Clone

CAT#: SC336389

TNFRSF8 (untagged) - Human tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), transcript variant 3


  "NM_001281430" in other vectors (1)

Reconstitution Protocol

USD 490.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNFRSF8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TNFRSF8
Synonyms CD30; D1S166E; Ki-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001281430, the custom clone sequence may differ by one or more nucleotides


ATGTTCTGTTCCACGTCTGCCGTCAACTCCTGTGCCCGCTGCTTCTTCCATTCTGTCTGTCCGGCAGGGA
TGATTGTCAAGTTCCCAGGCACGGCGCAGAAGAACACGGTCTGTGAGCCGGCTTCCCCAGGGGTCAGCCC
TGCCTGTGCCAGCCCAGAGAACTGCAAGGAACCCTCCAGTGGCACCATCCCCCAGGCCAAGCCCACCCCG
GTGTCCCCAGCAACCTCCAGTGCCAGCACCATGCCTGTAAGAGGGGGCACCCGCCTCGCCCAGGAAGCTG
CTTCTAAACTGACGAGGGCTCCCGACTCTCCCTCCTCTGTGGGAAGGCCTAGTTCAGATCCAGGTCTGTC
CCCAACACAGCCATGCCCAGAGGGGTCTGGTGATTGCAGAAAGCAGTGTGAGCCCGACTACTACCTGGAC
GAGGCCGGCCGCTGCACGGCCTGCGTGAGCTGTTCTCGAGATGACCTTGTGGAGAAGACGCCATGTGCAT
GGAACTCCTCCCGCACCTGCGAATGTCGACCTGGCATGATCTGTGCCACATCAGCCACCAACTCCTGTGC
CCGCTGTGTCCCCTACCCAATCTGTGCAGCAGAGACGGTCACCAAGCCCCAGGATATGGCTGAGAAGGAC
ACCACCTTTGAGGCGCCACCCCTGGGGACCCAGCCGGACTGCAACCCCACCCCAGAGAATGGCGAGGCGC
CTGCCAGCACCAGCCCCACTCAGAGCTTGCTGGTGGACTCCCAGGCCAGTAAGACGCTGCCCATCCCAAC
CAGCGCTCCCGTCGCTCTCTCCTCCACGGGGAAGCCCGTTCTGGATGCAGGGCCAGTGCTCTTCTGGGTG
ATCCTGGTGTTGGTTGTGGTGGTCGGCTCCAGCGCCTTCCTCCTGTGCCACCGGAGGGCCTGCAGGAAGC
GAATTCGGCAGAAGCTCCACCTGTGCTACCCGGTCCAGACCTCCCAGCCCAAGCTAGAGCTTGTGGATTC
CAGACCCAGGAGGAGCTCAACGCTGAGGAGTGGTGCGTCGGTGACAGAACCCGTCGCGGAAGAGCGAGGG
TTAATGAGCCAGCCACTGATGGAGACCTGCCACAGCGTGGGGGCAGCCTACCTGGAGAGCCTGCCGCTGC
AGGATGCCAGCCCGGCCGGGGGCCCCTCGTCCCCCAGGGACCTTCCTGAGCCCCGGGTGTCCACGGAGCA
CACCAATAACAAGATTGAGAAAATCTACATCATGAAGGCTGACACCGTGATCGTGGGGACCGTGAAGGCT
GAGCTGCCGGAGGGCCGGGGCCTGGCGGGGCCAGCAGAGCCCGAGTTGGAGGAGGAGCTGGAGGCGGACC
ATACCCCCCACTACCCCGAGCAGGAGACAGAACCGCCTCTGGGCAGCTGCAGCGATGTCATGCTCTCAGT
GGAAGAGGAAGGGAAAGAAGACCCCTTGCCCACAGCTGCCTCTGGAAAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001281430
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281430.2, NP_001268359.2
RefSeq Size 3616 bp
RefSeq ORF 1452 bp
Locus ID 943
Cytogenetics 1p36.22
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction
Gene Summary 'The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The encoded protein (isoform 3) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.