RUNX2 (NM_001278478) Human Untagged Clone

CAT#: SC336400

RUNX2 (untagged) - Human runt-related transcription factor 2 (RUNX2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RUNX2
• Synonyms: AML3; CBF-alpha-1; CBFA1; CCD; CCD1; CLCD; OSF-2; OSF2; PEA2aA; PEBP2aA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278478, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTATTCCCGTAGATCCGAGCACCAGCCGGCGCTTCAGCCCCCCCTCCAGCAGCCTGCAGCCCGGCA
  AAATGAGCGACGTGAGCCCGGTGGTGGCTGCGCAACAGCAGCAGCAACAGCAGCAGCAGCAACAGCAGCA
  GCAGCAGCAGCAACAGCAGCAGCAGCAGCAGGAGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCG
  GCGGCGGCAGCTGCAGTGCCCCGGTTGCGGCCGCCCCACGACAACCGCACCATGGTGGAGATCATCGCCG
  ACCACCCGGCCGAACTCGTCCGCACCGACAGCCCCAACTTCCTGTGCTCGGTGCTGCCCTCGCACTGGCG
  CTGCAACAAGACCCTGCCCGTGGCCTTCAAGGTGGTAGCCCTCGGAGAGGTACCAGATGGGACTGTGGTT
  ACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACC
  AAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCAT
  AACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCT
  CGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTG
  ATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAA
  CTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGCAGGCACAGTCTTCC
  CCGCCGTGGTCCTATGACCAGTCTTACCCCTCCTACCTGAGCCAGATGACGTCCCCGTCCATCCACTCTA
  CCACCCCGCTGTCTTCCACACGGGGCACTGGGCTTCCTGCCATCACCGATGTGCCTAGGCGCATTTCAGG
  TGCTTCAGAACTGGGCCCTTTTTCAGACCCCAGGCAGTTCCCAAGCATTTCATCCCTCACTGAGAGCCGC
  TTCTCCAACCCACGAATGCACTATCCAGCCACCTTTACTTACACCCCGCCAGTCACCTCAGGCATGTCCC
  TCGGTATGTCCGCCACCACTCACTACCACACCTACCTGCCACCACCCTACCCCGGCTCTTCCCAAAGCCA
  GAGTGGACCCTTCCAGACCAGCAGCACTCCATATCTCTACTATGGCACTTCGTCAGGATCCTATCAGTTT
  CCCATGGTGCCGGGGGGAGACCGGTCTCCTTCCAGAATGCTTCCGCCATGCACCACCACCTCGAATGGCA
  GCACGCTATTAAATCCAAATTTGCCTAACCAGAATGATGGTGTTGACGCTGATGGAAGCCACAGCAGTTC
  CCCAACTGTTTTGAATTCTAGTGGCAGAATGGATGAATCTGTTTGGCGACCATATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278478
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278478.1, NP_001265407.1
• RefSeq Size: 5235 bp
• RefSeq ORF: 1458 bp
• Locus ID: 860
• Cytogenetics: 6p21.1
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]'
  Transcript Variant: This variant (4) contains an alternate 5'-most exon, lacks an in-frame exon in the 3' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (d) has a distinct and shorter N-terminus, compared to isoform a.