Lipoamide Dehydrogenase (DLD) (NM_001289751) Human Untagged Clone

CAT#: SC336402

DLD (untagged) - Human dihydrolipoamide dehydrogenase (DLD), transcript variant 3


  "NM_001289751" in other vectors (1)

Reconstitution Protocol

USD 490.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DLD
Synonyms DLDD; DLDH; E3; GCSL; LAD; PHE3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289751, the custom clone sequence may differ by one or more nucleotides


ATGCAGAGCTGGAGTCGTGTGTACTGCTCCTTGGCCAAGAGAGGCCATTTCAATCGAATATCTCATGGCC
TACAGGGACTTTCTGCAGTGCCTCTGAGAACTTACGCAGATCAGCCGATTGATGCTGATGTAACAGTTAT
AGGTTCTGGTCCTGGAGGATATGTTGCTGCTATTAAAGCTGCCCAGTTAGGCTTCAAGGCTTTATTGAAC
AACTCTCATTATTACCATATGGCCCATGGAAAAGATTTTGCATCTAGAGGAATTGAAATGTCCGAAGTTC
GCTTGAATTTAGACAAGATGATGGAGCAGAAGAGTACTGCAGTAAAAGCTTTAACAGGTGGAATTGCCCA
CTTATTCAAACAGAATAAGGTTGTTCATGTCAATGGATATGGAAAGATAACTGGCAAAAATCAAGTCACT
GCTACGAAAGCTGATGGCGGCACTCAGGTTATTGATACAAAGAACATTCTTATAGCCACGGGTTCAGAAG
TTACTCCTTTTCCTGGAATCACGATAGATGAAGATACAATAGTGTCATCTACAGGTGCTTTATCTTTAAA
AAAAGTTCCAGAAAAGATGGTTGTTATTGGTGCAGGAGTAATAGGTGTAGAATTGGGTTCAGTTTGGCAA
AGACTTGGTGCAGATGTGACAGCAGTTGAATTTTTAGGTCATGTAGGTGGAGTTGGAATTGATATGGAGA
TATCTAAAAACTTTCAACGCATCCTTCAAAAACAGGGGTTTAAATTTAAATTGAATACAAAGGTTACTGG
TGCTACCAAGAAGTCAGATGGAAAAATTGATGTTTCTATTGAAGCTGCTTCTGGTGGTAAAGCTGAAGTT
ATCACTTGTGATGTACTCTTGGTTTGCATTGGCCGACGACCCTTTACTAAGAATTTGGGACTAGAAGAGC
TGGGAATTGAACTAGATCCCAGAGGTAGAATTCCAGTCAATACCAGATTTCAAACTAAAATTCCAAATAT
CTATGCCATTGGTGATGTAGTTGCTGGTCCAATGCTGGCTCACAAAGCAGAGGATGAAGGCATTATCTGT
GTTGAAGGAATGGCTGGTGGTGCTGTGCACATTGACTACAATTGTGTGCCATCAGTGATTTACACACACC
CTGAAGTTGCTTGGGTTGGCAAATCAGAAGAGCAGTTGAAAGAAGAGGGTATTGAGTACAAAGTTGGGAA
ATTCCCATTTGCTGCTAACAGCAGAGCTAAGACAAATGCTGACACAGATGGCATGGTGAAGATCCTTGGG
CAGAAATCGACAGACAGAGTACTGGGAGCACATATTCTTGGACCAGGTGCTGGAGAAATGGTAAATGAAG
CTGCTCTTGCTTTGGAATATGGAGCATCCTGTGAAGATATAGCTAGAGTCTGTCATGCACATCCGACCTT
ATCAGAAGCTTTTAGAGAAGCAAATCTTGCTGCGTCATTTGGCAAATCAATCAACTTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289751
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289751.1, NP_001276680.1
RefSeq Size 3544 bp
RefSeq ORF 1461 bp
Locus ID 1738
Cytogenetics 7q31.1
Protein Families Druggable Genome
Protein Pathways Citrate cycle (TCA cycle), Glycine, serine and threonine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pyruvate metabolism, Valine, leucine and isoleucine degradation
Gene Summary 'This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. Mutations in this gene have been identified in patients with E3-deficient maple syrup urine disease and lipoamide dehydrogenase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.