Lipoamide Dehydrogenase (DLD) (NM_001289751) Human Untagged Clone
CAT#: SC336402
DLD (untagged) - Human dihydrolipoamide dehydrogenase (DLD), transcript variant 3
"NM_001289751" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DLD |
Synonyms | DLDD; DLDH; E3; GCSL; LAD; PHE3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001289751, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGCTGGAGTCGTGTGTACTGCTCCTTGGCCAAGAGAGGCCATTTCAATCGAATATCTCATGGCC TACAGGGACTTTCTGCAGTGCCTCTGAGAACTTACGCAGATCAGCCGATTGATGCTGATGTAACAGTTAT AGGTTCTGGTCCTGGAGGATATGTTGCTGCTATTAAAGCTGCCCAGTTAGGCTTCAAGGCTTTATTGAAC AACTCTCATTATTACCATATGGCCCATGGAAAAGATTTTGCATCTAGAGGAATTGAAATGTCCGAAGTTC GCTTGAATTTAGACAAGATGATGGAGCAGAAGAGTACTGCAGTAAAAGCTTTAACAGGTGGAATTGCCCA CTTATTCAAACAGAATAAGGTTGTTCATGTCAATGGATATGGAAAGATAACTGGCAAAAATCAAGTCACT GCTACGAAAGCTGATGGCGGCACTCAGGTTATTGATACAAAGAACATTCTTATAGCCACGGGTTCAGAAG TTACTCCTTTTCCTGGAATCACGATAGATGAAGATACAATAGTGTCATCTACAGGTGCTTTATCTTTAAA AAAAGTTCCAGAAAAGATGGTTGTTATTGGTGCAGGAGTAATAGGTGTAGAATTGGGTTCAGTTTGGCAA AGACTTGGTGCAGATGTGACAGCAGTTGAATTTTTAGGTCATGTAGGTGGAGTTGGAATTGATATGGAGA TATCTAAAAACTTTCAACGCATCCTTCAAAAACAGGGGTTTAAATTTAAATTGAATACAAAGGTTACTGG TGCTACCAAGAAGTCAGATGGAAAAATTGATGTTTCTATTGAAGCTGCTTCTGGTGGTAAAGCTGAAGTT ATCACTTGTGATGTACTCTTGGTTTGCATTGGCCGACGACCCTTTACTAAGAATTTGGGACTAGAAGAGC TGGGAATTGAACTAGATCCCAGAGGTAGAATTCCAGTCAATACCAGATTTCAAACTAAAATTCCAAATAT CTATGCCATTGGTGATGTAGTTGCTGGTCCAATGCTGGCTCACAAAGCAGAGGATGAAGGCATTATCTGT GTTGAAGGAATGGCTGGTGGTGCTGTGCACATTGACTACAATTGTGTGCCATCAGTGATTTACACACACC CTGAAGTTGCTTGGGTTGGCAAATCAGAAGAGCAGTTGAAAGAAGAGGGTATTGAGTACAAAGTTGGGAA ATTCCCATTTGCTGCTAACAGCAGAGCTAAGACAAATGCTGACACAGATGGCATGGTGAAGATCCTTGGG CAGAAATCGACAGACAGAGTACTGGGAGCACATATTCTTGGACCAGGTGCTGGAGAAATGGTAAATGAAG CTGCTCTTGCTTTGGAATATGGAGCATCCTGTGAAGATATAGCTAGAGTCTGTCATGCACATCCGACCTT ATCAGAAGCTTTTAGAGAAGCAAATCTTGCTGCGTCATTTGGCAAATCAATCAACTTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289751 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289751.1, NP_001276680.1 |
RefSeq Size | 3544 bp |
RefSeq ORF | 1461 bp |
Locus ID | 1738 |
Cytogenetics | 7q31.1 |
Protein Families | Druggable Genome |
Protein Pathways | Citrate cycle (TCA cycle), Glycine, serine and threonine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pyruvate metabolism, Valine, leucine and isoleucine degradation |
Gene Summary | 'This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. Mutations in this gene have been identified in patients with E3-deficient maple syrup urine disease and lipoamide dehydrogenase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]' Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238508 | DLD (myc-DDK-tagged) - Human dihydrolipoamide dehydrogenase (DLD), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review