LAMA3 (NM_001302996) Human Untagged Clone

CAT#: SC336412

LAMA3 (untagged) - Human laminin, alpha 3 (LAMA3), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LAMA3
• Synonyms: BM600; E170; LAMNA; LOCS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302996, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCCGCGCGGCCTCGGGGTCGGGCACTGGGGCCAGTACTGCCGCCGACGCCGCTGCTCCTGC
  TGGTACTGCGGGTGCTGCCAGCCTGCGGGGCGACCGCTCGGGATCCCGGGGCCGCGGCCGGGCTCAGCCT
  TCACCCGACTTACTTCAACCTGGCCGAGGCGGCGAGGATTTGGGCCACCGCCACCTGCGGGGAGAGGGGA
  CCCGGCGAGGGGAGGCCCCAGCCCGAGCTCTACTGCAAGTTGGTCGGGGGCCCCACCGCCCCAGGCAGCG
  GCCACACCATCCAGGGCCAGTTCTGTGACTATTGCAATTCTGAAGACCCCAGGAAAGCACATCCTGTCAC
  CAATGCCATCGATGGATCTGAACGTTGGTGGCAAAGCCCTCCCCTGTCCTCAGGCACACAGTACAACAGA
  GTCAACCTCACCTTGGATCTGGGGCAGCTCTTCCATGTGGCCTATATTTTAATCAAATTTGCAAATTCTC
  CTCGCCCTGATCTTTGGGTCTTGGAAAGATCTGTAGACTTTGGAAGCACCTACTCACCATGGCAATATTT
  TGCTCATTCTAAAGTAGACTGTTTAAAAGAATTTGGGCGGGAGGCAAATATGGCTGTCACCCGGGATGAT
  GATGTACTTTGTGTTACTGAATATTCCCGTATTGTACCTTTGGAAAATGGTGAGGTTGTGGTGTCCTTGA
  TAAACGGTCGTCCAGGTGCAAAAAATTTTACTTTCTCTCACACCCTGAGGGAGTTTACCAAGGCAACAAA
  CATCCGCTTGCGTTTTCTTAGAACCAATACGCTTCTTGGACACCTCATCTCCAAAGCCCAGCGAGATCCA
  ACTGTCACTCGGCGGTATTATTACAGCATAAAGGACATCAGCATTGGTGGGCAGTGTGTTTGCAATGGCC
  ATGCTGAAGTGTGCAATATAAACAATCCTGAAAAACTGTTTCGGTGTGAATGCCAGCACCACACCTGTGG
  GGAGACGTGTGATCGCTGCTGCACAGGGTACAATCAGAGGCGCTGGCGGCCCGCCGCTTGGGAGCAGAGC
  CACGAGTGTGAAGCATGCAACTGCCACGGCCATGCCAGCAACTGTTACTATGATCCAGATGTTGAGCGGC
  AGCAGGCAAGCTTGAATACCCAGGGCATCTATGCTGGTGGAGGGGTCTGCATTAACTGTCAGCACAACAC
  AGCTGGAGTAAACTGTGAACAGTGTGCTAAGGGCTATTACCGCCCTTATGGGGTTCCAGTGGATGCCCCT
  GATGGCTGCATCCGTAAGTTTCATTTCAAGTTGGTGTATCTTAGCCTGTGTGTACTGCCTCAGCGAAGTC
  ATCAGGCTAACTTTGGATCAGTTAATAACTTCCTTCATGCCCTCTCTCTTCAGAGTATTAGTTGTGCTCG
  CTATGTGACCTCAGTCACTTACACAGTCTCTTTGAATTTTGGATTTATTGCATGTAAATGGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302996
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302996.1, NP_001289925.1
• RefSeq Size: 1749 bp
• RefSeq ORF: 1467 bp
• Locus ID: 3909
• Cytogenetics: 18q11.2
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: ECM-receptor interaction, Focal adhesion, Pathways in cancer, Small cell lung cancer
• Gene Summary: 'The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]'
  Transcript Variant: This variant (5, also known as LN1) lacks a large portion of the 3' coding region and has a distinct 3' coding region and 3' UTR compared to variant 1. The encoded isoform (5, also known as LaNt alpha31) has a distinct and shorter C-terminus than isoform 1. This variant is supported by experimental data in PMID:19773554.