KCNS3 (NM_001282428) Human Untagged Clone

CAT#: SC336427

KCNS3 (untagged) - Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), transcript variant 2


  "NM_001282428" in other vectors (1)

Reconstitution Protocol

USD 490.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNS3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNS3
Synonyms KV9.3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282428, the custom clone sequence may differ by one or more nucleotides


ATGGTGTTTGGTGAGTTTTTCCATCGCCCTGGACAAGACGAGGAACTTGTCAACCTGAATGTGGGGGGCT
TTAAGCAGTCTGTTGACCAAAGCACCCTCCTGCGGTTTCCTCACACCAGACTGGGGAAGCTGCTTACTTG
CCATTCTGAAGAGGCCATTCTGGAGCTGTGTGATGATTACAGTGTGGCCGATAAGGAATACTACTTTGAT
CGGAATCCCTCCTTGTTCAGATATGTTTTGAATTTTTATTACACGGGGAAGCTGCATGTCATGGAGGAGC
TGTGCGTATTCTCATTCTGCCAGGAGATCGAGTACTGGGGCATCAACGAGCTCTTCATTGATTCTTGCTG
CAGCAATCGCTACCAGGAACGCAAGGAGGAAAACCACGAGAAGGACTGGGACCAGAAAAGCCATGATGTG
AGTACCGACTCCTCGTTTGAAGAGTCGTCTCTGTTTGAGAAAGAGCTGGAGAAGTTTGACACACTGCGAT
TTGGTCAGCTCCGGAAGAAAATCTGGATTAGAATGGAGAATCCAGCGTACTGCCTGTCCGCTAAGCTTAT
CGCTATCTCCTCCTTGAGCGTGGTGCTGGCCTCCATCGTGGCCATGTGCGTTCACAGCATGTCGGAGTTC
CAGAATGAGGATGGAGAAGTGGATGATCCGGTGCTGGAAGGAGTGGAGATCGCGTGCATTGCCTGGTTCA
CCGGGGAGCTTGCCGTCCGGCTGGCTGCCGCTCCTTGTCAAAAGAAATTCTGGAAAAACCCTCTGAACAT
CATTGACTTTGTCTCTATTATTCCCTTCTATGCCACGTTGGCTGTAGACACCAAGGAGGAAGAGAGTGAG
GATATTGAGAACATGGGCAAGGTGGTCCAGATCCTACGGCTTATGAGGATTTTCCGAATTCTAAAGCTTG
CCCGGCACTCGGTAGGACTTCGGTCTCTAGGTGCCACACTGAGACACAGCTACCATGAAGTTGGGCTTCT
GCTTCTCTTCCTCTCTGTGGGCATTTCCATTTTCTCTGTGCTTATCTACTCCGTGGAGAAAGATGACCAC
ACATCCAGCCTCACCAGCATCCCCATCTGCTGGTGGTGGGCCACCATCAGCATGACAACTGTGGGCTATG
GAGACACCCACCCGGTCACCTTGGCGGGAAAGCTCATCGCCAGCACATGCATCATCTGTGGCATCTTGGT
GGTGGCCCTTCCCATCACCATCATCTTCAACAAGTTTTCCAAGTACTACCAGAAGCAAAAGGACATTGAT
GTGGACCAGTGCAGTGAGGATGCACCAGAGAAGTGTCATGAGCTACCTTACTTTAACATTAGGGATATAT
ATGCACAGCGGATGCACACCTTCATTACCAGTCTCTCTTCTGTAGGCATTGTGGTGAGCGATCCTGACTC
CACAGATGCTTCAAGCATTGAAGACAATGAGGACATTTGTAACACCACCTCCTTGGAGAATTGCACAGCA
AAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001282428
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282428.1, NP_001269357.1
RefSeq Size 2415 bp
RefSeq ORF 1476 bp
Locus ID 3790
Cytogenetics 2p24.2
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]'
Transcript Variant: This variant (2) has an alternate 5' terminal exon, compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.