Cytochrome P450 3A5 (CYP3A5) (NM_001291830) Human Untagged Clone

CAT#: SC336438

CYP3A5 (untagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 5 (CYP3A5), transcript variant 5


  "NM_001291830" in other vectors (1)

Reconstitution Protocol

USD 490.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP3A5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CYP3A5
Synonyms CP35; CYPIIIA5; P450PCN3; PCN3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291830, the custom clone sequence may differ by one or more nucleotides


ATGCAATTACTGATGTTGGAGTTGCTGTTATTATTTATCGTATATGGGACCCGTACACATGGACTTTTTA
AGAGACTGGGAATTCCAGGGCCCACACCTCTGCCTTTGTTGGGAAATGTTTTGTCCTATCGTCAGGGTCT
CTGGAAATTTGACACAGAGTGCTATAAAAAGTATGGAAAAATGTGGGGAACGTATGAAGGTCAACTCCCT
GTGCTGGCCATCACAGATCCCGACGTGATCAGAACAGTGCTAGTGAAAGAATGTTATTCTGTCTTCACAA
ATCGAAGGTCTTTAGGCCCAGTGGGATTTATGAAAAGTGCCATCTCTTTAGCTGAGGATGAAGAATGGAA
GAGAATACGGTCATTGCTGTCTCCAACCTTCACCAGCGGAAAACTCAAGGAGATGTTCCCCATCATTGCC
CAGTATGGAGATGTATTGGTGAGAAACTTGAGGCGGGAAGCAGAGAAAGGCAAGCCTGTCACCTTGAAAG
ACATCTTTGGGGCCTACAGCATGGATGTGATTACTGGCACATCATTTGGAGTGAACATCGACTCTCTCAA
CAATCCACAAGACCCCTTTGTGGAGAGCACTAAGAAGTTCCTAAAATTTGGTTTCTTAGATCCATTATTT
CTCTCAATAATACTCTTTCCATTCCTTACCCCAGTTTTTGAAGCATTAAATGTCTCTCTGTTTCCAAAAG
ATACCATAAATTTTTTAAGTAAATCTGTAAACAGAATGAAGAAAAGTCGCCTCAACGACAAACAAAAGCA
CCGACTAGATTTCCTTCAGCTGATGATTGACTCCCAGAATTCGAAAGAAACTGAGTCCCACAAAGCTCTG
TCTGATCTGGAGCTCGCAGCCCAGTCAATAATCTTCATTTTTGCTGGCTATGAAACCACCAGCAGTGTTC
TTTCCTTCACTTTATATGAACTGGCCACTCACCCTGATGTCCAGCAGAAACTGCAAAAGGAGATTGATGC
AGTTTTGCCCAATAAGGCACCACCTACCTATGATGCCGTGGTACAGATGGAGTACCTTGACATGGTGGTG
AATGAAACACTCAGATTATTCCCAGTTGCTATTAGACTTGAGAGGACTTGCAAGAAAGATGTTGAAATCA
ATGGGGTATTCATTCCCAAAGGGTCAATGGTGGTGATTCCAACTTATGCTCTTCACCATGACCCAAAGTA
CTGGACAGAGCCTGAGGAGTTCCGCCCTGAAAGGTTCAGTAAGAAGAAGGACAGCATAGATCCTTACATA
TACACACCCTTTGGAACTGGACCCAGAAACTGCATTGGCATGAGGTTTGCTCTCATGAACATGAAACTTG
CTCTAATCAGAGTCCTTCAGAACTTCTCCTTCAAACCTTGTAAAGAAACACAGATCCCCTTGAAATTAGA
CACGCAAGGACTTCTTCAACCAGAAAAACCCATTGTTCTAAAGGTGGATTCAAGAGATGGAACCCTAAGT
GGAGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001291830
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291830.1, NP_001278759.1
RefSeq Size 2015 bp
RefSeq ORF 1479 bp
Locus ID 1577
Cytogenetics 7q22.1
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism
Gene Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein metabolizes drugs as well as the steroid hormones testosterone and progesterone. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Two pseudogenes of this gene have been identified within this cluster on chromosome 7. Expression of this gene is widely variable among populations, and a single nucleotide polymorphism that affects transcript splicing has been associated with susceptibility to hypertensions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]'
Transcript Variant: This variant (5) differs in its 5' UTR and uses an alternate start codon, compared to variant 1. The encoded isoform (4) has a shorter and distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.