EYA3 (NM_001282562) Human Untagged Clone

CAT#: SC336593

EYA3 (untagged) - Human EYA transcriptional coactivator and phosphatase 3 (EYA3), transcript variant 4


  "NM_001282562" in other vectors (1)

Reconstitution Protocol

USD 530.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "EYA3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EYA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282562, the custom clone sequence may differ by one or more nucleotides


ATGACATGCACCGATTACATCCCTCGCTCATCCAATGATTATACCTCACAAATGTATTCTGCAAAACCTT
ATGCACATATTCTCTCAGTTCCTGTTTCGGAAACTGCTTACCCTGGACAGACTCAATACCAGACACTACA
GCAGACTCAACCCTATGCTGTCTACCCTCAGGCAACCCAAACGTATGGACTACCTCCTTTTGGTGCATTG
TGGCCAGGTATGAAACCTGAAAGTGGTTTAATTCAGACTCCATCTCCAAGTCAACACAGTGTTCTTACCT
GCACTACAGGGTTAACCACAAGCCAGCCAAGCCCAGCACATTATTCTTATCCCATTCAAGCTTCAAGCAC
AAATGCCAGCCTGATATCTACTTCTTCTACAATTGCCAATATTCCAGCAGCAGCAGTAGCCAGCATCTCA
AACCAGGATTATCCCACCTATACTATTCTTGGTCAGAATCAGTACCAGGCCTGCTACCCCAGCTCCAGCT
TTGGAGTCACAGGTCAGACTAACAGTGATGCAGAGAGCACCACATTAGCAGCAACCACATACCAGTCGGA
GAAGCCTAGTGTCATGGCGCCTGCACCTGCAGCACAGAGACTTTCCTCTGGAGACCCTTCTACAAGTCCA
TCTTTGTCCCAGACTACACCAAGTAAAGATACTGATGATCAGTCCAGGAAAAACATGACTAGCAAGAACC
GGGGCAAGAGGAAAGCTGATGCCACTTCTTCCCAAGACAGTGAATTAGAACGGGTATTTCTGTGGGACTT
GGATGAAACCATCATCATCTTCCACTCACTTCTTACTGGATCCTATGCCCAGAAATATGGAAAGGACCCA
ACAGTAGTGATTGGCTCAGGTTTAACAATGGAAGAAATGATTTTTGAAGTGGCTGATACTCATCTATTTT
TCAATGACTTAGAGGAGTGTGACCAGGTACATGTGGAAGATGTGGCTTCTGATGACAATGGCCAAGACTT
GAGCAACTACAGTTTCTCAACAGATGGTTTCAGTGGCTCAGGAGGTAGTGGCAGCCATGGTTCATCTGTG
GGTGTTCAGGGAGGTGTGGACTGGATGAGGAAACTAGCTTTCCGCTACCGGAAAGTGAGAGAAATCTATG
ATAAGCATAAAAGCAACGTGGGTGGTCTCCTCAGTCCCCAGAGGAAGGAAGCACTGCAGAGATTAAGAGC
AGAAATTGAAGTTTTAACAGATTCCTGGTTAGGAACTGCATTAAAGTCCTTACTTCTCATCCAGTCCAGA
AAGAATTGTGTGAATGTTCTGATCACTACCACCCAGCTGGTTCCAGCCCTGGCCAAGGTTCTCCTATATG
GACTAGGAGAAATATTTCCTATTGAGAACATCTATAGTGCTACCAAAATTGGTAAGGAGAGCTGCTTTGA
GAGAATTGTGTCAAGGTTTGGAAAGAAAGTCACATATGTAGTGATTGGAGATGGACGAGATGAAGAAATT
GCAGCCAAACAGCACAACATGCCTTTCTGGAGGATCACAAACCATGGAGACCTAGTATCCCTTCACCAGG
CTTTAGAGCTTGATTTTCTCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001282562
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282562.1, NP_001269491.1
RefSeq Size 5961 bp
RefSeq ORF 1563 bp
Locus ID 2140
Cytogenetics 1p35.3
Protein Families Phosphatase, Transcription Factors
Gene Summary 'This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]'
Transcript Variant: This variant (4) lacks an alternate exon in the 5' region which results in the use of a downstream in-frame start codon, compared to variant 1. The encoded isoform (d) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.