Acetylcholinesterase (ACHE) (NM_001282449) Human Untagged Clone
CAT#: SC336614
ACHE (untagged) - Human acetylcholinesterase (Yt blood group) (ACHE), transcript variant 3
"NM_001282449" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ACHE |
Synonyms | ACEE; ARACHE; N-ACHE; YT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282449, the custom clone sequence may differ by one or more nucleotides
ATGAGGCCCCCGCAGTGTCTGCTGCACACGCCTTCCCTGGCTTCCCCACTCCTTCTCCTCCTCCTCTGGC TCCTGGGTGGAGGAGTGGGGGCTGAGGGCCGGGAGGATGCAGAGCTGCTGGTGACGGTGCGTGGGGGCCG GCTGCGGGGCATTCGCCTGAAGACCCCCGGGGGCCCTGTCTCTGCTTTCCTGGGCATCCCCTTTGCGGAG CCACCCATGGGACCCCGTCGCTTTCTGCCACCGGAGCCCAAGCAGCCTTGGTCAGGGGTGGTAGACGCTA CAACCTTCCAGAGTGTCTGCTACCAATATGTGGACACCCTATACCCAGGTTTTGAGGGCACCGAGATGTG GAACCCCAACCGTGAGCTGAGCGAGGACTGCCTGTACCTCAACGTGTGGACACCATACCCCCGGCCTACA TCCCCCACCCCTGTCCTCGTCTGGATCTATGGGGGTGGCTTCTACAGTGGGGCCTCCTCCTTGGACGTGT ACGATGGCCGCTTCTTGGTACAGGCCGAGAGGACTGTGCTGGTGTCCATGAACTACCGGGTGGGAGCCTT TGGCTTCCTGGCCCTGCCGGGGAGCCGAGAGGCCCCGGGCAATGTGGGTCTCCTGGATCAGAGGCTGGCC CTGCAGTGGGTGCAGGAGAACGTGGCAGCCTTCGGGGGTGACCCGACATCAGTGACGCTGTTTGGGGAGA GCGCGGGAGCCGCCTCGGTGGGCATGCACCTGCTGTCCCCGCCCAGCCGGGGCCTGTTCCACAGGGCCGT GCTGCAGAGCGGTGCCCCCAATGGACCCTGGGCCACGGTGGGCATGGGAGAGGCCCGTCGCAGGGCCACG CAGCTGGCCCACCTTGTGGGCTGTCCTCCAGGCGGCACTGGTGGGAATGACACAGAGCTGGTAGCCTGCC TTCGGACACGACCAGCGCAGGTCCTGGTGAACCACGAATGGCACGTGCTGCCTCAAGAAAGCGTCTTCCG GTTCTCCTTCGTGCCTGTGGTAGATGGAGACTTCCTCAGTGACACCCCAGAGGCCCTCATCAACGCGGGA GACTTCCACGGCCTGCAGCTGGCTGGGCGACTGGCTGCCCAGGGTGCCCGGGTCTACGCCTACGTCTTTG AACACCGTGCTTCCACGCTCTCCTGGCCCCTGTGGATGGGGGTGCCCCACGGCTACGAGATCGAGTTCAT CTTTGGGATCCCCCTGGACCCCTCTCGAAACTACACGGCAGAGGAGAAAATCTTCGCCCAGCGACTGATG CGATACTGGGCCAACTTTGCCCGCACAGGGGATCCCAATGAGCCCCGAGACCCCAAGGCCCCACAATGGC CCCCGTACACGGCGGGGGCTCAGCAGTACGTTAGTCTGGACCTGCGGCCGCTGGAGGTGCGGCGGGGGCT GCGCGCCCAGGCCTGCGCCTTCTGGAACCGCTTCCTCCCCAAATTGCTCAGCGCCACCGACACGCTCGAC GAGGCGGAGCGCCAGTGGAAGGCCGAGTTCCACCGCTGGAGCTCCTACATGGTGCACTGGAAGAACCAGT TCGACCACTACAGCAAGCAGGATCGCTGCTCAGACCTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282449 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282449.1, NP_001269378.1 |
RefSeq Size | 2012 bp |
RefSeq ORF | 1581 bp |
Locus ID | 43 |
Cytogenetics | 7q22.1 |
Protein Families | Druggable Genome |
Protein Pathways | Glycerophospholipid metabolism |
Gene Summary | 'Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. AChE activity may constitute a sensitive biomarker of RBC ageing in vivo, and thus, may be of aid in understanding the effects of transfusion[provided by RefSeq, Sep 2019]' Transcript Variant: This variant (3) uses an alternate splice acceptor site compared to variant E4-E6. The encoded isoform (3) is shorter than isoform E4-E6. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238720 | ACHE (myc-DDK-tagged) - Human acetylcholinesterase (Yt blood group) (ACHE), transcript variant 3 |
USD 480.00 |
{0} Product Review(s)
Be the first one to submit a review