Stromal interaction molecule 1 (STIM1) (NM_001277962) Human Untagged Clone

CAT#: SC336697

STIM1 (untagged) - Human stromal interaction molecule 1 (STIM1), transcript variant 3


  "NM_001277962" in other vectors (1)

Reconstitution Protocol

USD 550.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "STIM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STIM1
Synonyms D11S4896E; GOK; IMD10; STRMK; TAM; TAM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001277962, the custom clone sequence may differ by one or more nucleotides


ATGGATGTATGCGTCCGTCTTGCCCTGTGGCTCCTCTGGGGACTCCTCCTGCACCAGGGCCAGAGCCTCA
GCCATAGTCACAGTGAGAAGGCGACAGGAACCAGCTCGGGGGCCAACTCTGAGGAGTCCACTGCAGCAGA
GTTTTGCCGAATTGACAAGCCCCTGTGTCACAGTGAGGATGAGAAACTCAGCTTCGAGGCAGTCCGTAAC
ATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGG
AAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGT
GGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGG
CTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCA
TGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCG
GCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTTGACTCGCCATAATCAC
CTCAAGGACTTCATGCTGGTGGTGTCTATCGTTATTGGTGTGGGCGGCTGCTGGTTTGCCTATATCCAGA
ACCGTTACTCCAAGGAGCACATGAAGAAGATGATGAAGGACTTGGAGGGGTTACACCGAGCTGAGCAGAG
TCTGCATGACCTTCAGGAAAGGCTGCACAAGGCCCAGGAGGAGCACCGCACAGTGGAGGTGGAGAAGGTC
CATCTGGAAAAGAAGCTGCGCGATGAGATCAACCTTGCTAAGCAGGAAGCCCAGCGGCTGAAGGAGCTGC
GGGAGGGTACTGAGAATGAGCGGAGCCGCCAAAAATATGCTGAGGAGGAGTTGGAGCAGGTTCGGGAGGC
CTTGAGGAAAGCAGAGAAGGAGCTAGAATCTCACAGCTCATGGTATGCTCCAGAGGCCCTTCAGAAGTGG
CTGCAGCTGACACATGAGGTGGAGGTGCAATATTACAACATCAAGAAGCAAAATGCTGAGAAGCAGCTGC
TGGTGGCCAAGGAGGGGGCTGAGAAGATAAAAAAGAAGAGAAACACACTCTTTGGCACCTTCCACGTGGC
CCACAGCTCTTCCCTGGATGATGTAGATCATAAAATTCTAACAGCTAAGCAAGCACTGAGCGAGGTGACA
GCAGCATTGCGGGAGCGCCTGCACCGCTGGCAACAGATCGAGATCCTCTGTGGCTTCCAGATTGTCAACA
ACCCTGGCATCCACTCACTGGTGGCTGCCCTCAACATAGACCCCAGCTGGATGGGCAGTACACGCCCCAA
CCCTGCTCACTTCATCATGACTGACGACGTGGATGACATGGATGAGGAGATTGTGTCTCCCTTGTCCATG
CAGTCCCCTAGCCTGCAGAGCAGTGTTCGGCAGCGCCTGACGGAGCCACAGCATGGCCTGGGATCTCAGA
GAGGATCATCTCTAAAGGCAAACAGGCTCTCTAGTAAGGGATTTGACCCATTCCGATTCGGAGTCCTCCC
TCCACATGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001277962
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277962.1, NP_001264891.1
RefSeq Size 4099 bp
RefSeq ORF 1623 bp
Locus ID 6786
Cytogenetics 11p15.4
Protein Families Transmembrane
Gene Summary 'This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]'
Transcript Variant: This variant (3) contains an alternate exon and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting protein (isoform 3) has a distinct C-terminus and is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.