Hyaluronan synthase 1 (HAS1) (NM_001297436) Human Untagged Clone

CAT#: SC336856

HAS1 (untagged) - Human hyaluronan synthase 1 (HAS1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HAS1
• Synonyms: HAS
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297436, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGACAGGACGCGCCCAAGCCCACTCCTGCAGCCTGCCGCTGCTCCGGCCTGGCCCGGAGGGTGCTGA
  CCATCGCCTTCGCCCTGCTCATCCTGGGCCTCATGACCTGGGCCTACGCCGCCGGGGTGCCGCTGGCCTC
  CGATCGCTACGGCCTCCTGGCCTTCGGCCTCTACGGGGCCTTCCTTTCAGCGCACCTGGTGGCGCAGAGC
  CTCTTCGCGTACCTGGAGCACCGGCGGGTGGCGGCGGCGGCGCGGGGGCCGCTGGATGCAGCCACCGCGC
  GCAGTGTGGCGCTGACCATCTCCGCCTACCAGGAGGACCCCGCGTACCTGCGCCAGTGCCTGGCGTCCGC
  CCGCGCCCTGCTGTACCCGCGCGCGCGGCTGCGCGTCCTCATGGTGGTGGATGGCAACCGCGCCGAGGAC
  CTCTACATGGTCGACATGTTCCGCGAGGTCTTCGCTGACGAGGACCCCGCCACGTACGTGTGGGACGGCA
  ACTACCACCAGCCCTGGGAACCCGCGGCGGCGGGCGCGGTGGGCGCCGGAGCCTATCGGGAGGTGGAGGC
  GGAGGATCCTGGGCGGCTGGCAGTGGAGGCGCTGGTGAGGACTCGCAGGTGCGTGTGCGTGGCGCAGCGC
  TGGGGCGGCAAGCGCGAGGTCATGTACACAGCCTTCAAGGCGCTCGGAGATTCGGTGGACTACGTGCAGG
  TCTGTGACTCGGACACAAGGTTGGACCCCATGGCACTGCTGGAGCTCGTGCGGGTACTGGACGAGGACCC
  CCGGGTAGGGGCTGTTGGTGGGGACGTGCGGATCCTTAACCCTCTGGACTCCTGGGTCAGCTTCCTAAGC
  AGCCTGCGATACTGGGTAGCCTTCAATGTGGAGCGGGCTTGTCAGAGCTACTTCCACTGTGTATCCTGCA
  TCAGCGGTCCTCTAGGCCTATATAGGAATAACCTCTTGCAGCAGTTTCTTGAGGCCTGGTACAACCAGAA
  GTTCCTGGGTACCCACTGTACTTTTGGGGATGACCGGCACCTCACCAACCGCATGCTCAGCATGGGTTAT
  GCTACCAAGTACACCTCCAGGTCCCGCTGCTACTCAGAGACGCCCTCGTCCTTCCTGCGGTGGCTGAGCC
  AGCAGACACGCTGGTCCAAGTCGTACTTCCGTGAGTGGCTGTACAACGCGCTCTGGTGGCACCGGCACCA
  TGCGTGGATGACCTACGAGGCGGTGGTCTCCGGCCTGTTCCCCTTCTTCGTGGCGGCCACTGTGCTGCGT
  CTGTTCTACGCGGGCCGCCCTTGGGCGCTGCTGTGGGTGCTGCTGTGCGTGCAGGGCGTGGCACTGGCCA
  AGGCGGCCTTCGCGGCCTGGCTGCGGGGCTGCCTGCGCATGGTGCTTCTGTCGCTCTACGCGCCCCTCTA
  CATGTGTGGCCTCCTGCCTGCCAAGTTCCTGGCGCTAGTCACCATGAACCAGAGTGGCTGGGGCACCTCG
  GGCCGGCGGAAGCTGGCCGCTAACTACGTCCCTCTGCTGCCCCTGGCGCTCTGGGCGCTGCTGCTGCTTG
  GGGGCCTGGTCCGCAGCGTAGCACACGAGGCCAGGGCCGACTGGAGCGGCCCTTCCCGCGCAGCCGAGGC
  CTACCACTTGGCCGCGGGGGCCGGCGCCTACGTGGGCTACTGGGTGGCCATGTTGACGCTGTACTGGGTG
  GGCGTGCGGAGGCTTTGCCGGCGGCGGACCGGGGGCTACCGCGTCCAGGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297436
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297436.1, NP_001284365.1
• RefSeq Size: 2137 bp
• RefSeq ORF: 1734 bp
• Locus ID: 3036
• Cytogenetics: 19q13.41
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. It encodes isoform 2, which is shorter by an amino acid, compared to isoform 1.