Sequencing Primer, Sequencing Primer, TRE_F

CAT#: GE100141

Forward primer to sequence targets cloned in expression vectors.


USD 71.00

In Stock*

Size
    • 1 nmol

Product Images

Specifications

Product Data
Sequence GAGAACGTATAAGCATTAGG
Applicable Vectors PS100124, PS100125
Components 1 vial of lyophilized sequencing primer (1 nmol, sufficient for 100 sequencing reactions)
Quality Control The primer has been tested to generate satisfactory sequencing data on ABI 3730.
Storage Store at -20°C.
Stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.