Sequencing Primer, Sequencing Primer, TRE_F
USD 71.00
In Stock*
Size
Product Images
Specifications
Product Data | |
Sequence | GAGAACGTATAAGCATTAGG |
Applicable Vectors | PS100124, PS100125 |
Components | 1 vial of lyophilized sequencing primer (1 nmol, sufficient for 100 sequencing reactions) |
Quality Control | The primer has been tested to generate satisfactory sequencing data on ABI 3730. |
Storage | Store at -20°C. |
Stability | The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C |
Documents
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.