NDUFB3 Human qPCR Primer Pair (NM_002491)
USD 120.00
5 Days*
Size
Product Images
Frequently bought together (1)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
Other products for "NDUFB3"
Specifications
Product Data | |
Gene ID | 4709 |
Forward Sequence | CCAGAAGAAGCTGGCTGCAAAAG |
Reverse Sequence | GAATACATCAGAAAAGGAAACACTC |
Accession No | NM_002491 |
Synonyms | B12; CI-B12; MC1DN25 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT |
Storage | The primer mix is stable for one year from date of shipping. Store at -20°C. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
Aberrant Hippocampal Connectivity in Unmedicated Patients With Schizophrenia and Effects of Antipsychotic Medication: A Longitudinal Resting State Functional MRI Study
Kraguljac, White, Hadley et al
Schizophr Bull (2016) 42 (4), 1046-55 DOI: 10.1093/schbul/sbv228
Kraguljac, White, Hadley et al
Schizophr Bull (2016) 42 (4), 1046-55 DOI: 10.1093/schbul/sbv228
Early changes in the hypothalamic region in prodromal Huntington disease revealed by MRI analysis
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Evaluation of optimized b-value sampling schemas for diffusion kurtosis imaging with an application to stroke patient data
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Preparing for selective inhibition within frontostriatal loops
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Genetic influences on sociability: heightened amygdala reactivity and event-related responses to positive social stimuli in Williams syndrome
Haas, Mills, Yam et al
J Neurosci (2009) 29 (4), 1132-9 DOI: 10.1523/JNEUROSCI.5324-08.2009
Haas, Mills, Yam et al
J Neurosci (2009) 29 (4), 1132-9 DOI: 10.1523/JNEUROSCI.5324-08.2009
Showing 1-5 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.