Mir144 Mouse qPCR Primer Pair (MI0000168)

CAT#: MP300068

Mir144 (Mouse) qSTAR miRNA primer pairs - 200 reactions



SensiMix SYBR Master Mix

USD 160.00

3 Days*

Size
    • 200 reactions

Product Images

Other products for "Mir144"

Specifications

Product Data
Gene ID 387162
Forward Sequence TACAGTATAGATGATGTACT
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0000156
Synonyms MI0000168; MIMAT0000156; Mir144 mmu-mir-144; mmu-miR-144
Quality Control The primer mix has been pre-validated on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

Early changes in the hypothalamic region in prodromal Huntington disease revealed by MRI analysis
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Evaluation of optimized b-value sampling schemas for diffusion kurtosis imaging with an application to stroke patient data
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Preparing for selective inhibition within frontostriatal loops
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Showing 1-5 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.