MIR363 Rat qPCR Template Standard (MI0003553)

CAT#: RK300271

MIR363 (Rat) qSTAR miRNA primer pairs + Copy number standard kit



SensiMix SYBR Master Mix

USD 330.00

2 Weeks*

Size
    • 200 reactions

Product Images

Other products for "MIR363"

Specifications

Product Data
Application Plasmid of exact quantity for transcript copy number calculation
Forward Sequence CGGGTGGATCACGATGCAAT
Reverse Sequence GAACATGTCTGCGTATCTC
Accession No MIMAT0003209
Synonyms MI0003553; MIMAT0003209; MIR363 rno-mir-363; rno-miR-363-5p
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage The primer mix and template standard are stable for one year from date of shipping. Store at -20°C.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

Early changes in the hypothalamic region in prodromal Huntington disease revealed by MRI analysis
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Evaluation of optimized b-value sampling schemas for diffusion kurtosis imaging with an application to stroke patient data
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Preparing for selective inhibition within frontostriatal loops
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Showing 1-5 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.