Mir363 Mouse MicroRNA Expression Plasmid (MI0000765)
USD 396.00
In Stock*
Size
Product Images
Frequently bought together (1)
Other products for "Mir363"
Specifications
Product Data | |
Species | Mouse |
Vector | pCMV-MIR |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Precursor:
UGUUAUCAGGUGGAACACGAUGCAAUUUUGGUUGGUGUAAUAGGAGGAAAAUUGCACGGUAUCCAUCUGUAAACC
Mature Sequence:
AAUUGCACGGUAUCCAUCUGUA
>MI0000765
CAGATTTGCAGTTCAGCGTATATGTGAATATATGGCTGTGCAAATCCATGCAAAACTGATTGTGGGAATG
TGTACCTTTCTGCATCGTAATGGACACCTTTATGCACATCTTCAGCATCCATGCCCATTCATCCACAGGT GGGGATTGGTGGCATTACTTGTGTTAGATATAAAGTATTGCACTTGTCCCGGCCTGAGGAAGAAAGAGGG TTTTTAATCGTCTTTTAGTTTCTGAGTATTGTAAGTTATGTTAGACTGTAATTATGAAATGAACTGTTTT GCTGTTATCAGGTGGAACACGATGCAATTTTGGTTGGTGTAATAGGAGGAAAATTGCACGGTATCCATCT GTAAACCGCAGGACCTATGTGGACAGCCGTCTATCAGTGCTATAGTAAGATTGTAAAATCCTTTAGCTAG TCATTGCTTTGAACACATTTGGAGTGGATTTTTTTTTTTTTTTTTTGGTTTTTCAAGACAGAGTTTCTCT GTATAGCCCTGGCTGTCCTGGAACTCACTCAGGGTGGCCTCGAACTCAGAAATCTGCCTGCCTCTGCCTC CCAAGTGCTGGGATCAAAGGCGTGCGCCACCACGCCCAGCTTGGAGTCTAATTTTTTAAAACTACATATT TTTAAATATATTTGAAATCCT |
OTI Disclaimer | All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA. |
Product Components |
|
Also Contains | MI0000580, MI0000765 Both mature and minor (star) miRNA can be over expressed from the construct. |
Reference Data | |
RefSeq | MI0000765 |
Synonyms | mmu-mir-363 |
Locus ID | 723852 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
RNAi Resources |
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
Aberrant Hippocampal Connectivity in Unmedicated Patients With Schizophrenia and Effects of Antipsychotic Medication: A Longitudinal Resting State Functional MRI Study
Kraguljac, White, Hadley et al
Schizophr Bull (2016) 42 (4), 1046-55 DOI: 10.1093/schbul/sbv228
Kraguljac, White, Hadley et al
Schizophr Bull (2016) 42 (4), 1046-55 DOI: 10.1093/schbul/sbv228
Early changes in the hypothalamic region in prodromal Huntington disease revealed by MRI analysis
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Soneson, Fontes, Zhou et al
Neurobiol Dis (2010) 40 (3), 531-43 DOI: 10.1016/j.nbd.2010.07.013
Evaluation of optimized b-value sampling schemas for diffusion kurtosis imaging with an application to stroke patient data
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Yan, Zhou, Ying et al
Comput Med Imaging Graph (2013) 37 (4), 272-80 DOI: 10.1016/j.compmedimag.2013.04.007
Preparing for selective inhibition within frontostriatal loops
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Smittenaar, Guitart-Masip, Lutti et al
J Neurosci (2013) 33 (46), 18087-97 DOI: 10.1523/JNEUROSCI.2167-13.2013
Genetic influences on sociability: heightened amygdala reactivity and event-related responses to positive social stimuli in Williams syndrome
Haas, Mills, Yam et al
J Neurosci (2009) 29 (4), 1132-9 DOI: 10.1523/JNEUROSCI.5324-08.2009
Haas, Mills, Yam et al
J Neurosci (2009) 29 (4), 1132-9 DOI: 10.1523/JNEUROSCI.5324-08.2009
Showing 1-5 of 27 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.