Lenti FAQs

1. Is there any safety issue with this pLenti vector?

The pLenti vector is a third generation lentiviral vector and it is the safest lenti-viral vector because both LTRs are truncated. Please contact the biosafety office at your institution prior to use of the pLenti vector for permission and for further institution-specific instructions. BL2/(+) conditions should be used at all times when handling lentivirus. All decontamination steps should be performed using 70% ethanol/1% SDS. Gloves should be worn at all times when handling lentiviral preparations, transfected cells or the combined transfection reagent and lentiviral DNA.

2. What is unique about the 3rd generation of Lentiviral vectors?

The 3rd generation lentiviral vectors are safer than the 2nd generation vectors. The 3rd generation packaging systems express gag and pol from one packaging vector and rev from another. The 3rd generation packaging systems DO NOT express tat (Trans-Activator of Transcription).

3. What cell line should be used in order to produce lentivirus?

HEK293T cells are commonly used to produce lentivirus. The HEK293T cell line for producing lentiviral particles can be obtained from ATCC.

4. How do I clone an insert into the pLenti vector?

The multiple-cloning site of the pLenti vector is compatible with OriGene’s PrecisionShuttling system, a simple cut-and-ligation process. Please refer to the corresponding protocols in the TrueORF application guide.

5. Can pLenti vectors be used in direct transfections as opposed to making virus?

OriGene’s pLenti vectors can also be used in transient transfections to achieve expression of the transgene. This usually involves lower levels of protein production due to diminished transfection efficiency.

6. What is the difference between a lentivirus and a retrovirus?

Lenti viruses are a subtype of retrovirus. The main difference between lentiviruses and standard retroviruses from an experimental standpoint is lentiviruses are capable of infecting both non-dividing and actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types. Both lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging. However, the isoforms of these proteins used by retroviruses and lentiviruses are different and lentiviral vectors may not be efficiently packaged by each other’s packaging systems.

7. Sequences of the sequencing primers:

EF50 (forward seq primer for lenti-EF1a vectors)
5’ CTTCCATTTCAGGTGTCGTGAC 3’  TM: 55C

V2 (forward seq primer for lenti-CMV vectors)
5’ AGAGCTCGTTTAGTGAA  3’ TM: 42C

LR50 (reverse seq primer for lenti-ORF vectors)
5’ CAGAGGTTGATTATCGATAAG 3’ TM: 48.5C

8. How do I propagate the pLenti vector in E. coli?

Due to the direct repeats of LTR regions of the lentiviral vectors, recombination deficient E. coli competent cells are recommended, such as Stbl3 from ThermoFisher, cat# A10469.

9. Can I use the pLenti vector for stable selection in mammalian cells?

Some of the pLenti vectors have mammalian selectable markers and those without a mammalian selection marker cannot be used for mammalian selection. There are two types of selection markers, antibiotics or fluorescent proteins. View details of the vectors.

10. What is the size limit for the ORF that is to be cloned into the pLenti vector?

In general, lentiviral vectors have the capacity to accommodate an insert of 9 kb. We have successfully cloned ORFs of 6kb into pLenti-C-Myc-DDK vector and packaged into lentivirus. For lentiviral vectors with more features such as vectors containing selection markers, the ORF size limit will be smaller accordingly.

11. Can I use a second generation packaging system with the pLenti vectors?

Yes, a second generation packaging system should work with OriGene’s third generation pLenti vectors although we have not explicitly tested this. You can use OriGene’s third generation packaging kit, cat# TR30037 for pLenti-vectors.

12. Can I use OriGene’s Lenti-vpack packaging kit to package a second generation lentiviral vector?

No. OriGene’s Lenti-vpack packaging kit is used for the third generation lentiviral vectors, such as all of the lentiviral vectors from OriGene.

13. What is MOI? What MOI should I use for my cell line?

MOI stands for Multiplicity Of Infection, the number of lentiviral particles per cell. The optimal MOI for each cell line varies. For each cell line, a range of MOI from 5-100 needs to be tested using a positive control particles containing a fluorescent protein marker, such as OriGene's GFP control lentiviral particle (cat# PS100071V).

The chart below shows the recommended MOI for common cell lines as a point of reference.

Cell lines	Recommeneded MOI
A549	40
C2C12	200
Caco2	100
HCT116	20
HEK293T	20
Hela	80
Hep3B	50
HuH7	20
Jurkat	40
MCF-7	60
NK92	50
PC3	40
SH-SY5Y	5
SKNMC	20
THP1	80
U2OS	20

14. What is the WPRE element that OriGene has included in their lentiviral vectors?

Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a posttranscriptional regulatory element, which is transcribed, but not translated. When WPRE is inserted in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield for genes delivered by viral vectors.