Adenylosuccinate Lyase (ADSL) (NM_001123378) Human 3' UTR Clone

CAT#: SC200009

3`UTR clone of adenylosuccinate lyase (ADSL) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADSL
• Synonyms: AMPS; ASASE; ASL
• ACCN: NM_001123378
• Insert Size: 55 bp
• Sequence Data:
  Insert Sequence

  >SC200009 3'UTR clone of NM_001123378
  The sequence shown below is from the reference sequence of NM_001123378. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001123378.1
• Summary: 'The protein encoded by this gene belongs to the lyase 1 family. It is an essential enzyme involved in purine metabolism, and catalyzes two non-sequential reactions in the de novo purine biosynthetic pathway: the conversion of succinylaminoimidazole carboxamide ribotide (SAICAR) to aminoimidazole carboxamide ribotide (AICAR) and the conversion of adenylosuccinate (S-AMP) to adenosine monophosphate (AMP). Mutations in this gene are associated with adenylosuccinase deficiency (ADSLD), a disorder marked with psychomotor retardation, epilepsy or autistic features. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]'
• Locus ID: 158