COX6A2 (NM_005205) Human 3' UTR Clone

CAT#: SC200060

3`UTR clone of cytochrome c oxidase subunit VIa polypeptide 2 (COX6A2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX6A2
• Synonyms: COX6AH; COXVIAH
• ACCN: NM_005205
• Insert Size: 81 bp
• Sequence Data:
  Insert Sequence

  >SC200060 3'UTR clone of NM_005205
  The sequence shown below is from the reference sequence of NM_005205. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAATAGCCACGTGAACCCTCTGCCCACGGGCTACGAACACCCCTGAGGCCCCGGACGCCCCCGGACACAA
  TAAAGGTGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005205.2
• Summary: 'Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (heart/muscle isoform) of subunit VIa, and polypeptide 2 is present only in striated muscles. Polypeptide 1 (liver isoform) of subunit VIa is encoded by a different gene, and is found in all non-muscle tissues. These two polypeptides share 66% amino acid sequence identity. [provided by RefSeq, Jul 2008]'
• Locus ID: 1339