LIPC (NM_000236) Human 3' UTR Clone
CAT#: SC200081
3`UTR clone of lipase hepatic (LIPC) for miRNA target validation
Product Images
Other products for "LIPC"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | LIPC |
Synonyms | HDLCQ12; HL; HTGL; LIPH |
ACCN | NM_000236 |
Insert Size | 45 |
Sequence Data |
>SC200081 3'UTR clone of NM_000236
The sequence shown below is from the reference sequence of NM_000236. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CAAAGCGAAAGATCAGATGAGATTTAATGAAGACCCAGTGTAAAG ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_000236.2 |
Summary | LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008] |
Locus ID | 3990 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.