LIPC (NM_000236) Human 3' UTR Clone

CAT#: SC200081

3`UTR clone of lipase hepatic (LIPC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIPC
• Synonyms: HDLCQ12; HL; HTGL; LIPH
• ACCN: NM_000236
• Insert Size: 45
• Sequence Data:
  Insert Sequence

  >SC200081 3'UTR clone of NM_000236
  The sequence shown below is from the reference sequence of NM_000236. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGCGAAAGATCAGATGAGATTTAATGAAGACCCAGTGTAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000236.2
• Summary: LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
• Locus ID: 3990