glutathione S transferase Omega 1 (GSTO1) (NM_004832) Human 3' UTR Clone

CAT#: SC200099

3`UTR clone of glutathione S-transferase omega 1 (GSTO1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTO1
• Synonyms: GSTO 1-1; GSTTLp28; HEL-S-21; P28; SPG-R
• ACCN: NM_004832
• Insert Size: 45
• Sequence Data:
  Insert Sequence

  >SC200099 3'UTR clone of NM_004832
  The sequence shown below is from the reference sequence of NM_004832. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGTGACTATGGGCTCTGAAGGGGGCAGGAGTCAGCAATAAAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004832.1
• Summary: The protein encoded by this gene is an omega class glutathione S-transferase (GST) with glutathione-dependent thiol transferase and dehydroascorbate reductase activities. GSTs are involved in the metabolism of xenobiotics and carcinogens. The encoded protein acts as a homodimer and is found in the cytoplasm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
• Locus ID: 9446