liver FABP (FABP1) (NM_001443) Human 3' UTR Clone

CAT#: SC200147

3`UTR clone of fatty acid binding protein 1 liver (FABP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FABP1
• Synonyms: FABPL; L-FABP
• ACCN: NM_001443
• Insert Size: 101
• Sequence Data:
  Insert Sequence

  >SC200147 3'UTR clone of NM_001443
  The sequence shown below is from the reference sequence of NM_001443. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTGACATTGTCTTCAAGAGAATCAGCAAGAGAATTTAAACAAGTCTGCATTTCATATTATTTTAGTGTG
  TAAAATTAATGTAATAAAGTGAACTTTGTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001443.1
• Summary: This gene encodes the fatty acid binding protein found in liver. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. This protein and FABP6 (the ileal fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Mar 2011]
• Locus ID: 2168