RPL36A (NM_021029) Human 3' UTR Clone

CAT#: SC200160

3`UTR clone of ribosomal protein L36a (RPL36A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPL36A
• Synonyms: L36A; L44L; MIG6; RPL44
• ACCN: NM_021029
• Insert Size: 61 bp
• Sequence Data:
  Insert Sequence

  >SC200160 3'UTR clone of NM_021029
  The sequence shown below is from the reference sequence of NM_021029. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAAGTGATCCAGTTCTAAGTGTCATCTTTTATTATGAAGACAATAAAATCTTGAGTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021029.4
• Summary: 'Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. Although this gene has been referred to as ribosomal protein L44 (RPL44), its official name is ribosomal protein L36a (RPL36A). This gene and the human gene officially named ribosomal protein L36a-like (RPL36AL) encode nearly identical proteins; however, they are distinct genes. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Naturally occurring read-through transcription occurs between this locus and the heterogeneous nuclear ribonucleoprotein H2 (H') gene. [provided by RefSeq, Jan 2011]'
• Locus ID: 6173