EEF1B2 (NM_021121) Human 3' UTR Clone
CAT#: SC200161
3`UTR clone of eukaryotic translation elongation factor 1 beta 2 (EEF1B2) transcript variant 2 for miRNA target validation
Product Images
Other products for "EEF1B2"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | EEF1B2 |
Synonyms | EEF1B; EEF1B1; EF1B |
ACCN | NM_021121 |
Insert Size | 52 bp |
Sequence Data |
>SC200161 3'UTR clone of NM_021121
The sequence shown below is from the reference sequence of NM_021121. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_021121.3 |
Summary | 'This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]' |
Locus ID | 1933 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.