FOXP1 (NM_001012505) Human 3' UTR Clone

CAT#: SC200190

3`UTR clone of forkhead box P1 (FOXP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FOXP1
• Synonyms: 12CC4; hFKH1B; HSPC215; MFH; QRF1
• ACCN: NM_001012505
• Insert Size: 37 bp
• Sequence Data:
  Insert Sequence

  >SC200190 3'UTR clone of NM_001012505
  The sequence shown below is from the reference sequence of NM_001012505. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGAAGATGAGTGGACCTGTGTGTCAGCCTAACCCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001012505.1
• Summary: This gene belongs to subfamily P of the forkhead box (FOX) transcription factor family. Forkhead box transcription factors play important roles in the regulation of tissue- and cell type-specific gene transcription during both development and adulthood. Forkhead box P1 protein contains both DNA-binding- and protein-protein binding-domains. This gene may act as a tumor suppressor as it is lost in several tumor types and maps to a chromosomal region (3p14.1) reported to contain a tumor suppressor gene(s). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 27086