KCNQ2 (NM_172109) Human 3' UTR Clone

CAT#: SC200191

3`UTR clone of potassium voltage-gated channel KQT-like subfamily member 2 (KCNQ2) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNQ2
• Synonyms: BFNC; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2
• ACCN: NM_172109
• Insert Size: 110 bp
• Sequence Data:
  Insert Sequence

  >SC200191 3'UTR clone of NM_172109
  The sequence shown below is from the reference sequence of NM_172109. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGCCACCAAGCAACTGTTTCATTTTTTATTTTCCATTTGTTCTTAAACCCCACTTTTTGTTGTTCATTA
  TTTTGATTGATTTTTTTTCTTTAAAATGTATTTTTCACAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_172109.1
• Summary: 'The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3785