Methionyl tRNA synthetase (MARS) (NM_004990) Human 3' UTR Clone

CAT#: SC200218

3`UTR clone of methionyl-tRNA synthetase (MARS) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MARS"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MARS
Synonyms CMT2U; ILFS2; ILLD; METRS; MRS; MTRNS; SPG70
ACCN NM_004990
Insert Size 71 bp
Sequence Data
>SC200218 3'UTR clone of NM_004990
The sequence shown below is from the reference sequence of NM_004990. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCCCCTAAAGGCAAGAAGAAAAAGTAAAAGACCTTGGCTCATAGAAAGTCACTTTAATAGATAGGGACA
G

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004990.2
Summary 'This gene encodes a member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. The encoded protein is a component of the multi-tRNA synthetase complex and catalyzes the ligation of methionine to tRNA molecules. [provided by RefSeq, Jan 2011]'
Locus ID 4141

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.