FABP6 (NM_001130958) Human 3' UTR Clone
CAT#: SC200247
3`UTR clone of fatty acid binding protein 6 ileal (FABP6) transcript variant 3 for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "FABP6"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | FABP6 |
Synonyms | I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP |
ACCN | NM_001130958 |
Insert Size | 84 bp |
Sequence Data |
>SC200247 3'UTR clone of NM_001130958
The sequence shown below is from the reference sequence of NM_001130958. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CATCGGAGGCGTGACCTATGAGCGCGTGAGCAAGAGACTGGCCTAAGCAGCCAGGCCCGGCCCAGGGAGC TACAAACCCACCAA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_001130958.1 |
Summary | 'This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. [provided by RefSeq, Jul 2008]' |
Locus ID | 2172 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.