RPS4Y1 (NM_001008) Human 3' UTR Clone

CAT#: SC200290

3`UTR clone of ribosomal protein S4 Y-linked 1 (RPS4Y1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPS4Y1
• Synonyms: RPS4Y; S4
• ACCN: NM_001008
• Insert Size: 68 bp
• Sequence Data:
  Insert Sequence

  >SC200290 3'UTR clone of NM_001008
  The sequence shown below is from the reference sequence of NM_001008. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAAACAGAGCAGTGGCTAAATTGCAGTAGCAGCATATCTTTTTTTCTTTGCACAAATAAACAGTGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001008.3
• Summary: 'Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes ribosomal protein S4, a component of the 40S subunit. Ribosomal protein S4 is the only ribosomal protein known to be encoded by more than one gene, namely this gene and ribosomal protein S4, X-linked (RPS4X). The 2 isoforms encoded by these genes are not identical, but are functionally equivalent. Ribosomal protein S4 belongs to the S4E family of ribosomal proteins. It has been suggested that haploinsufficiency of the ribosomal protein S4 genes plays a role in Turner syndrome; however, this hypothesis is controversial. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'
• Locus ID: 6192