Trehalase (TREH) (NM_007180) Human 3' UTR Clone

CAT#: SC200310

3`UTR clone of trehalase (brush-border membrane glycoprotein) (TREH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TREH
• Synonyms: TRE; TREA; TREHD
• ACCN: NM_007180
• Insert Size: 79
• Sequence Data:
  Insert Sequence

  >SC200310 3'UTR clone of NM_007180
  The sequence shown below is from the reference sequence of NM_007180. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTCAGCCTCCTGCCATGGTGACAGCCCTCCTCTCCTCACCTGGCCCCAGCTCCTGCCCCATTAAACCT
  CTGCACCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007180.2
• Summary: This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
• Locus ID: 11181