DCXR (NM_016286) Human 3' UTR Clone

CAT#: SC200347

3`UTR clone of dicarbonyl/L-xylulose reductase (DCXR) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DCXR
• Synonyms: DCR; HCR2; HCRII; KIDCR; P34H; PNTSU; SDR20C1; XR
• ACCN: NM_016286
• Insert Size: 121
• Sequence Data:
  Insert Sequence

  >SC200347 3'UTR clone of NM_016286
  The sequence shown below is from the reference sequence of NM_016286. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACGGGTTCCACTTTGCCGGTGGAAGGGGGCTTCTGGGCCTGCTGAGCTCCCTCCACACACCTCAAGCCC
  CATGCCGTGCTCATCCTACCCCCAATCCCTCCAATAAACCTGATTCTGCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016286.2
• Summary: The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
• Locus ID: 51181