XRCC1 (NM_006297) Human 3' UTR Clone

CAT#: SC200358

3`UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 1 (XRCC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: XRCC1
• Synonyms: RCC; SCAR26
• ACCN: NM_006297
• Insert Size: 118 bp
• Sequence Data:
  Insert Sequence

  >SC200358 3'UTR clone of NM_006297
  The sequence shown below is from the reference sequence of NM_006297. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCCTCACCAGCTCTATGGGGTGGTGCCGCAAGCCTGAAGTATGTGCTATACACACACACACACACACAC
  ACACACACACACACACACGATGCATTTAATAAAGATGAGTTGGTTCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006297.2
• Summary: 'The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]'
• Locus ID: 7515