hemoglobin subunit gamma 1 (HBG1) (NM_000559) Human 3' UTR Clone

CAT#: SC200439

3`UTR clone of hemoglobin gamma A (HBG1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HBG1
• Synonyms: HBG-T2; HBGA; HBGR; HSGGL1; PRO2979
• ACCN: NM_000559
• Insert Size: 105 bp
• Sequence Data:
  Insert Sequence

  >SC200439 3'UTR clone of NM_000559
  The sequence shown below is from the reference sequence of NM_000559. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCTCCAGATACCACTGAGCTCACTGCCCATGATTCAGAGCTTTCAAGGATAGGCTTTATTCTGCAAGCA
  ATACAAATAATAAATCTATTCTGCTGAGAGATCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000559.2
• Summary: 'The gamma globin genes (HBG1 and HBG2) are normally expressed in the fetal liver, spleen and bone marrow. Two gamma chains together with two alpha chains constitute fetal hemoglobin (HbF) which is normally replaced by adult hemoglobin (HbA) at birth. In some beta-thalassemias and related conditions, gamma chain production continues into adulthood. The two types of gamma chains differ at residue 136 where glycine is found in the G-gamma product (HBG2) and alanine is found in the A-gamma product (HBG1). The former is predominant at birth. The order of the genes in the beta-globin cluster is: 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]'
• Locus ID: 3047