UTY (NM_182660) Human 3' UTR Clone

CAT#: SC200468

3`UTR clone of ubiquitously transcribed tetratricopeptide repeat gene Y-linked (UTY) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UTY
• Synonyms: KDM6AL; KDM6C; UTY1
• ACCN: NM_182660
• Insert Size: 88 bp
• Sequence Data:
  Insert Sequence

  >SC200468 3'UTR clone of NM_182660
  The sequence shown below is from the reference sequence of NM_182660. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATTACAGGTGTGAGCCACCATGCCCGGTAAACTTTTAAAAATGTAAGCAAAATTACAGTATGTAAAAC
  ACACATTGCTAATGGAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_182660.1
• Summary: 'This gene encodes a protein containing tetratricopeptide repeats which are thought to be involved in protein-protein interactions. The encoded protein is also a minor histocompatibility antigen which may induce graft rejection of male stem cell grafts. A large number of alternatively spliced transcripts have been observed for this gene, but the full length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2012]'
• Locus ID: 7404