MPG (NM_001015054) Human 3' UTR Clone
CAT#: SC200477
3`UTR clone of N-methylpurine-DNA glycosylase (MPG) transcript variant 3 for miRNA target validation
Product Images
Other products for "MPG"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | MPG |
Synonyms | AAG; ADPG; anpg; APNG; CRA36.1; MDG; Mid1; PIG11; PIG16 |
ACCN | NM_001015054 |
Insert Size | 89 bp |
Sequence Data |
>SC200477 3'UTR clone of NM_001015054
The sequence shown below is from the reference sequence of NM_001015054. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CGACAGAGTGGCTGAGCAGGACACACAGGCCTGAGCAAAGGGCCTGCCCAGACAAGATTTTTTAATTGTT TAAAAACCGAATAAATGTT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_001015054.1 |
Summary | '' |
Locus ID | 4350 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.