PAX3 (NM_013942) Human 3' UTR Clone

CAT#: SC200511

3`UTR clone of paired box 3 (PAX3) transcript variant PAX3B for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PAX3
• Synonyms: CDHS; HUP2; WS1; WS3
• ACCN: NM_013942
• Insert Size: 116 bp
• Sequence Data:
  Insert Sequence

  >SC200511 3'UTR clone of NM_013942
  The sequence shown below is from the reference sequence of NM_013942. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGCGAGCGAGGAAAGGCCCTGGTCTCCGGAGTTTCCTCGCATTAAAGGAGAGAGAGAGAGAGTACTCT
  TTTGGGCAACGGCCCTCCAAAATTGCCCCCACATTGGCTGCCTTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013942.3
• Summary: 'This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]'
• Locus ID: 5077