CENTB1 (ACAP1) (NM_014716) Human 3' UTR Clone
CAT#: SC200526
3`UTR clone of ArfGAP with coiled-coil ankyrin repeat and PH domains 1 (ACAP1) for miRNA target validation
Product Images
Other products for "ACAP1"
Specifications
| Product Data | |
| Vector | pMirTarget |
| Species | Human |
| Transfection Reporter | RFP |
| Assay Reporter | Luciferase |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Symbol | ACAP1 |
| Synonyms | CENTB1 |
| ACCN | NM_014716 |
| Insert Size | 88 |
| Sequence Data |
>SC200526 3'UTR clone of NM_014716
The sequence shown below is from the reference sequence of NM_014716. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC ATGACCTCCACACGCTGTGACCCGAGGCCCACGGGGCCCGCGCCTGCCTCCCTTCCCCGCCACCGGGCCC TCTGCCATTAAAGCCTCC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
| Restriction Sites | SgfI-MluI |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
| Reference Data | |
| RefSeq | NM_014716.3 |
| Locus ID | 9744 |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China