Bim (BCL2L11) (NM_207002) Human 3' UTR Clone

CAT#: SC200531

3`UTR clone of BCL2-like 11 (apoptosis facilitator) (BCL2L11) transcript variant 9 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BCL2L11
• Synonyms: BAM; BIM; BOD
• ACCN: NM_207002
• Insert Size: 97
• Sequence Data:
  Insert Sequence

  >SC200531 3'UTR clone of NM_207002
  The sequence shown below is from the reference sequence of NM_207002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAACCACAAGGATTTCTCATGATACCTTTTTATAGCCACAGCCACCTCTCTCCCTCTTCCTTGAGCAT
  TTTGTCATATGGTCATTGGTGATTAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_207002.2
• Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013]
• Locus ID: 10018