RPL19 (NM_000981) Human 3' UTR Clone
CAT#: SC200546
3`UTR clone of ribosomal protein L19 (RPL19) for miRNA target validation
Product Images
Other products for "RPL19"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | RPL19 |
Synonyms | L19 |
ACCN | NM_000981 |
Insert Size | 80 bp |
Sequence Data |
>SC200546 3'UTR clone of NM_000981
The sequence shown below is from the reference sequence of NM_000981. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC ATCCAAGGAGGAAGAGACCAAGAAATAAAACCTCCCACTTTGTCTGTACATACTGGCCTCTGTGATTACA TAGATCAGCC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_000981.3 |
Summary | 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L19E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]' |
Locus ID | 6143 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.