BCL2 (NM_000657) Human 3' UTR Clone
CAT#: SC200550
3`UTR clone of B-cell CLL/lymphoma 2 (BCL2) nuclear gene encoding mitochondrial protein transcript variant beta for miRNA target validation
Product Images
Other products for "BCL2"
Specifications
| Product Data | |
| Vector | pMirTarget |
| Species | Human |
| Transfection Reporter | RFP |
| Assay Reporter | Luciferase |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Symbol | BCL2 |
| Synonyms | Bcl-2; PPP1R50 |
| ACCN | NM_000657 |
| Insert Size | 90 bp |
| Sequence Data |
>SC200550 3'UTR clone of NM_000657
The sequence shown below is from the reference sequence of NM_000657. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CTTGGTGATGTGAGTCTGGGCTGAGGCCACAGGTCCGAGATGCGGGGGTTGGAGTGCGGGTGGGCTCCTG GGGCAATGGGAGGCTGTGGA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
| Restriction Sites | SgfI-MluI |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
| Reference Data | |
| RefSeq | NM_000657.2 |
| Summary | 'This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]' |
| Locus ID | 596 |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China