ICAM3 (NM_002162) Human 3' UTR Clone

CAT#: SC200568

3`UTR clone of intercellular adhesion molecule 3 (ICAM3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ICAM3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ICAM3
Synonyms CD50; CDW50; ICAM-R
ACCN NM_002162
Insert Size 85 bp
Sequence Data
>SC200568 3'UTR clone of NM_002162
The sequence shown below is from the reference sequence of NM_002162. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAACCGTCCAGAGCTGAGTGACGCTGGGATCCGGGATCAAAGTTGGCGGGGGCTTGGCTGTGCCCTCA
GATTCCGCACCAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002162.3
Summary 'The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]'
Locus ID 3385

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.