ICAM3 (NM_002162) Human 3' UTR Clone
CAT#: SC200568
3`UTR clone of intercellular adhesion molecule 3 (ICAM3) for miRNA target validation
Product Images
Other products for "ICAM3"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ICAM3 |
Synonyms | CD50; CDW50; ICAM-R |
ACCN | NM_002162 |
Insert Size | 85 bp |
Sequence Data |
>SC200568 3'UTR clone of NM_002162
The sequence shown below is from the reference sequence of NM_002162. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC AAGAACCGTCCAGAGCTGAGTGACGCTGGGATCCGGGATCAAAGTTGGCGGGGGCTTGGCTGTGCCCTCA GATTCCGCACCAATA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_002162.3 |
Summary | 'The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]' |
Locus ID | 3385 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.