ICAM3 (NM_002162) Human 3' UTR Clone

CAT#: SC200568

3`UTR clone of intercellular adhesion molecule 3 (ICAM3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ICAM3
• Synonyms: CD50; CDW50; ICAM-R
• ACCN: NM_002162
• Insert Size: 85 bp
• Sequence Data:
  Insert Sequence

  >SC200568 3'UTR clone of NM_002162
  The sequence shown below is from the reference sequence of NM_002162. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGAACCGTCCAGAGCTGAGTGACGCTGGGATCCGGGATCAAAGTTGGCGGGGGCTTGGCTGTGCCCTCA
  GATTCCGCACCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002162.3
• Summary: 'The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein is constitutively and abundantly expressed by all leucocytes and may be the most important ligand for LFA-1 in the initiation of the immune response. It functions not only as an adhesion molecule, but also as a potent signalling molecule. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]'
• Locus ID: 3385