Dectin 1 (CLEC7A) (NM_197954) Human 3' UTR Clone

CAT#: SC200577

3`UTR clone of C-type lectin domain family 7 member A (CLEC7A) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLEC7A
• Synonyms: BGR; CANDF4; CD369; CLECSF12; DECTIN1; SCARE2
• ACCN: NM_197954
• Insert Size: 95
• Sequence Data:
  Insert Sequence

  >SC200577 3'UTR clone of NM_197954
  The sequence shown below is from the reference sequence of NM_197954. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGGTTTCAAAGCTGTGGAATTCAAAGGATAAATTAATGAAGAAAACAAGCGGAGCTGAAGAAGAAAGT
  ACAATATGGTGCTGTCTTCCTAATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_197954.2
• Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. The encoded glycoprotein is a small type II membrane receptor with an extracellular C-type lectin-like domain fold and a cytoplasmic domain with an immunoreceptor tyrosine-based activation motif. It functions as a pattern-recognition receptor that recognizes a variety of beta-1,3-linked and beta-1,6-linked glucans from fungi and plants, and in this way plays a role in innate immune response. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
• Locus ID: 64581