MRPL55 (NM_181463) Human 3' UTR Clone

CAT#: SC200582

3`UTR clone of mitochondrial ribosomal protein L55 (MRPL55) nuclear gene encoding mitochondrial protein transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MRPL55
• Synonyms: AAVG5835; L55nt; MRP-L55; PRO19675
• ACCN: NM_181463
• Insert Size: 106
• Sequence Data:
  Insert Sequence

  >SC200582 3'UTR clone of NM_181463
  The sequence shown below is from the reference sequence of NM_181463. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACCGACAGTTCTGGACCAGGACCAAGAAGTGACCGTGGCTCCAGCCACCCCGGGACATTGCTAAGATGG
  GAGGGCTGTTCTTAAATCACTCGTTCTTGAAGCTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_181463.2
• Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
• Locus ID: 128308