MRPL55 (NM_181463) Human 3' UTR Clone

CAT#: SC200582

3`UTR clone of mitochondrial ribosomal protein L55 (MRPL55) nuclear gene encoding mitochondrial protein transcript variant 5 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRPL55"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MRPL55
Synonyms AAVG5835; L55nt; MRP-L55; PRO19675
ACCN NM_181463
Insert Size 106
Sequence Data
>SC200582 3'UTR clone of NM_181463
The sequence shown below is from the reference sequence of NM_181463. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TACCGACAGTTCTGGACCAGGACCAAGAAGTGACCGTGGCTCCAGCCACCCCGGGACATTGCTAAGATGG
GAGGGCTGTTCTTAAATCACTCGTTCTTGAAGCTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181463.2
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding two different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Locus ID 128308

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.