DCI (ECI1) (NM_001919) Human 3' UTR Clone

CAT#: SC200593

3`UTR clone of dodecenoyl-Coenzyme A delta isomerase (32 trans-enoyl-Coenzyme A isomerase) (DCI) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ECI1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ECI1
Synonyms DCI
ACCN NM_001919
Insert Size 103 bp
Sequence Data
>SC200593 3'UTR clone of NM_001919
The sequence shown below is from the reference sequence of NM_001919. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAGATGTACTTAGAGAGGCTCAAAGAAGAAAAAGGCTAACGATTGGGCTGCCACAGGCTTACGGCCACA
CGTGCCCCTGTGGGTCCCAGGGAGGTCTTAAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001919.2
Summary 'This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]'
Locus ID 1632

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.