DPM3 (NM_153741) Human 3' UTR Clone
CAT#: SC200655
3`UTR clone of dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3) transcript variant 2 for miRNA target validation
Product Images
Other products for "DPM3"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | DPM3 |
Synonyms | CDG1O |
ACCN | NM_153741 |
Insert Size | 77 |
Sequence Data |
>SC200655 3'UTR clone of NM_153741
The sequence shown below is from the reference sequence of NM_153741. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC AGCCGACTTAGCCCGCAGGGGGCTGCGCTTCTGACAGCCTAACCCCATTCCTGTGCGGACAGCCCTTCCT CCCATTT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_153741.1 |
Summary | Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a subunit of dolichyl-phosphate mannosyltransferase and acts as a stabilizer subunit of the dolichyl-phosphate mannosyltransferase complex. [provided by RefSeq, Jul 2008] |
Locus ID | 54344 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.