HEPC (HAMP) (NM_021175) Human 3' UTR Clone

CAT#: SC200659

3`UTR clone of hepcidin antimicrobial peptide (HAMP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HAMP
• Synonyms: HEPC; HFE2B; LEAP1; PLTR
• ACCN: NM_021175
• Insert Size: 99
• Sequence Data:
  Insert Sequence

  >SC200659 3'UTR clone of NM_021175
  The sequence shown below is from the reference sequence of NM_021175. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGTGTGGGATGTGCTGCAAGACGTAGAACCTACCTGCCCTGCCCCCGTCCCCTCCCTTCCTTATTTA
  TTCCTGCTGCCCCAGAACATAGGTCTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_021175.2
• Summary: The product encoded by this gene is involved in the maintenance of iron homeostasis, and it is necessary for the regulation of iron storage in macrophages, and for intestinal iron absorption. The preproprotein is post-translationally cleaved into mature peptides of 20, 22 and 25 amino acids, and these active peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta-sheet structures. These peptides exhibit antimicrobial activity against bacteria and fungi. Mutations in this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure. [provided by RefSeq, Oct 2014]
• Locus ID: 57817