GSTA5 (NM_153699) Human 3' UTR Clone

CAT#: SC200704

3`UTR clone of glutathione S-transferase alpha 5 (GSTA5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTA5
• Synonyms: glutathione S-transferase A5; glutathione S-transferase alpha 5; glutathione transferase A5; OTTHUMP00000016610
• ACCN: NM_153699
• Insert Size: 117
• Sequence Data:
  Insert Sequence

  >SC200704 3'UTR clone of NM_153699
  The sequence shown below is from the reference sequence of NM_153699. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGCAAGGAAGATTTTCAGGTTTTAATAAAGCAGCTATGGAGGCCAAGAACATGCCAGACCAATATTCT
  ACAGTTTGCAACAATGAAGTGCTTTACCTAAGTGTGGATTGTGCCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_153699.1
• Summary: The glutathione S-transferases (GST; EC 2.5.1.18) catalyze the conjugation of reduced glutathiones and a variety of electrophiles, including many known carcinogens and mutagens. The cytosolic GSTs belong to a large superfamily, with members located on different chromosomes. For additional information on GSTs, see GSTA1 (MIM 138359). [supplied by OMIM, Sep 2008]
• Locus ID: 221357