5HT4 Receptor (HTR4) (NM_001040171) Human 3' UTR Clone

CAT#: SC200732

3`UTR clone of 5-hydroxytryptamine (serotonin) receptor 4 (HTR4) transcript variant d for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HTR4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HTR4
Synonyms 5-HT4; 5-HT4R
ACCN NM_001040171
Insert Size 106 bp
Sequence Data
>SC200732 3'UTR clone of NM_001040171
The sequence shown below is from the reference sequence of NM_001040171. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGATCCACACATGTACTAAGATTTTGAGCTCCTTGAGGACTGTGGCCAATTCTTATTGCTCATTTTTTTT
TCTTAGTGCCCAACACAGGTTTTTGTACACTGAAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001040171.1
Summary 'This gene is a member of the family of serotonin receptors, which are G protein coupled receptors that stimulate cAMP production in response to serotonin (5-hydroxytryptamine). The gene product is a glycosylated transmembrane protein that functions in both the peripheral and central nervous system to modulate the release of various neurotransmitters. Multiple transcript variants encoding proteins with distinct C-terminal sequences have been described. [provided by RefSeq, May 2010]'
Locus ID 3360

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.